Top » Catalog » SNPs » Y97307

$18.00

Y97307
[Y97307]

Y97307
hg38 Position: ChrY:14679861..14679861
Ancestral: C
Derived: A
Reference: YFull (2017)
ISOGG Haplogroup: E1b
Comments: Below V13 > Z5016 > BY4461
Forward Primer: Y97307_F AACAGTCATCTTCACTCTCTACTGTG
Reverse Primer: Y97307_R CCAAGAGGAGAAAAAGTTTGAGAG
Reviews

Customers who bought this product also purchased
Z17107
Z17107
BY4455
BY4455
Z5016
Z5016
Z17264
Z17264
Y161798
Y161798
Z16988
Z16988
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies