Top » Catalog » SNPs » Y97307

$18.00

Y97307
[Y97307]

Y97307
hg38 Position: ChrY:14679861..14679861
Ancestral: C
Derived: A
Reference: YFull (2017)
ISOGG Haplogroup: E1b
Comments: Below V13 > Z5016 > BY4461
Forward Primer: Y97307_F AACAGTCATCTTCACTCTCTACTGTG
Reverse Primer: Y97307_R CCAAGAGGAGAAAAAGTTTGAGAG
Reviews

Customers who bought this product also purchased
S19928
S19928
Y161799
Y161799
Z5018
Z5018
BY4600
BY4600
BY4461
BY4461
Z5017
Z5017
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies