Top » Catalog » SNPs » Y5595

$18.00

Y5595
[Y5595]

Y5595
hg38 Position: ChrY:9028270..9028270
Ancestral: G
Derived: T
Reference: Yfull (2014)
ISOGG Haplogroup: I2a
Comments: Below S17250 > Z16971
Forward Primer: Y5595_F GGCATGCTGTACCTAGAAATCG
Reverse Primer: Y5595_R CAGTCAGCCTTTTCCCCTG
Reviews

Customers who bought this product also purchased
Y52621
Y52621
Y99196
Y99196
A12505
A12505
A11115
A11115
A1328
A1328
BY106777
BY106777
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies