Top » Catalog » SNPs » JFS0026

$18.00

JFS0026
[JFS0026]

JFS0026
hg38 Position: ChrY:15573108..15573108
Ancestral: A
Derived: T
Reference: John Sloan (2017)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream of U198 > DF89 > FGC12307
Forward Primer: JFS0026_F ATCACATTTTGCAAAGATAGTTTGG
Reverse Primer: JFS0026_R ATGGAGAGTAGAAGTTGTGATTACTCAG
Reviews

Customers who bought this product also purchased
JFS0005
JFS0005
R1b-U106 Superclade Panel
R1b-U106 Superclade Panel
S15627
S15627
JFS0029
JFS0029
S1687
S1687
JFS0071
JFS0071
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies