Top » Catalog » SNPs » JFS0026

$18.00

JFS0026
[JFS0026]

JFS0026
hg38 Position: ChrY:15573108..15573108
Ancestral: A
Derived: T
Reference: John Sloan (2017)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream of U198 > DF89 > FGC12307
Forward Primer: JFS0026_F ATCACATTTTGCAAAGATAGTTTGG
Reverse Primer: JFS0026_R ATGGAGAGTAGAAGTTGTGATTACTCAG
Reviews

Customers who bought this product also purchased
Z301
Z301
JFS0004
JFS0004
FT3093
FT3093
L48
L48
FGC12307
FGC12307
JFS0005
JFS0005
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies