Top » Catalog » SNPs » JFS0071

$18.00

JFS0071
[JFS0071]

JFS0071
hg38 Position: ChrY:12531592..12531592
Ancestral: G
Derived: T
Reference: Michael Sager & John Sloan (2017)
ISOGG Haplogroup: R1b
Comments: DF89 > FGC12307 (found with FGC58724)
Forward Primer: JFS0071_F TAACAGTAATGGGTTTACCAAAGTGAAG
Reverse Primer: JFS0071_R GCTGGGACTACAGGCATGG
Reviews

Customers who bought this product also purchased
S1687
S1687
JFS0029
JFS0029
S1688
S1688
FGC12309
FGC12309
Z301
Z301
JFS0004
JFS0004
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies