Top » Catalog » SNPs » JFS0071

$18.00

JFS0071
[JFS0071]

JFS0071
hg38 Position: ChrY:12531592..12531592
Ancestral: G
Derived: T
Reference: Michael Sager & John Sloan (2017)
ISOGG Haplogroup: R1b
Comments: DF89 > FGC12307 (found with FGC58724)
Forward Primer: JFS0071_F TAACAGTAATGGGTTTACCAAAGTGAAG
Reverse Primer: JFS0071_R GCTGGGACTACAGGCATGG
Reviews

Customers who bought this product also purchased
R1b-U106 Superclade Panel
R1b-U106 Superclade Panel
S15627
S15627
JFS0026
JFS0026
S1687
S1687
JFS0029
JFS0029
S1688
S1688
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies