Top » Catalog » SNPs » FGC33442

$15.00

FGC33442
[FGC33442]

FGC33442
hg38 Position: ChrY:14832232..14832232
Ancestral: T
Derived: G
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FGC33442_F CACCCTGAGTTTCTTTAAACTGAATAG
Reverse Primer: FGC33442_R GATAGACGAGCATCTCCAACAAC
Reviews

Customers who bought this product also purchased
Y67661
Y67661
DC917
DC917
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies