Top » Catalog » SNPs » Y128405

$15.00

Y128405
[Y128405]

Y128405
hg38 Position: ChrY:14653724..14653724
Ancestral: A
Derived: G
Reference: YFull (2018)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: Y128405_F GGGGGACTCTGTCTCACTCTC
Reverse Primer: Y128405_R GACAAAATCTAATTGAAGATACAGGCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies