Top » Catalog » SNPs » Y128405

$18.00

Y128405
[Y128405]

Y128405
hg38 Position: ChrY:14653724..14653724
Ancestral: A
Derived: G
Reference: YFull (2018)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: Y128405_F GGGGGACTCTGTCTCACTCTC
Reverse Primer: Y128405_R GACAAAATCTAATTGAAGATACAGGCC
Reviews

Customers who bought this product also purchased
Y128413
Y128413
Y128324
Y128324
Y128822
Y128822
Y128522
Y128522
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies