Top » Catalog » SNPs » Y128413

$18.00

Y128413
[Y128413]

Y128413
hg38 Position: ChrY:7496894..7496894
Ancestral: C
Derived: G
Reference: YFull (2018)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: Y128413_F ATGTGCTATTTCTTGCAGGCTG
Reverse Primer: Y128413_R CCTGTACTATCAGCAACAATGACATG
Reviews

Customers who bought this product also purchased
Y128405
Y128405
Y128822
Y128822
Y128522
Y128522
Y128324
Y128324
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies