Top » Catalog » SNPs » Y128413

$15.00

Y128413
[Y128413]

Y128413
hg38 Position: ChrY:7496894..7496894
Ancestral: C
Derived: G
Reference: YFull (2018)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: Y128413_F ATGTGCTATTTCTTGCAGGCTG
Reverse Primer: Y128413_R CCTGTACTATCAGCAACAATGACATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies