Top » Catalog » SNPs » Y128522

$18.00

Y128522
[Y128522]

Y128522
hg38 Position: ChrY:13495918..13495918
Ancestral: C
Derived: T
Reference: YFull (2018)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: Y128522_F AATTCATATGCGATAGTCCACCC
Reverse Primer: Y128522_R TAAGTAATTCCTAGAACTGGGTTGGG
Reviews

Customers who bought this product also purchased
Y128822
Y128822
Y128413
Y128413
Y128324
Y128324
Y128405
Y128405
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies