Top » Catalog » SNPs » Y128822

$18.00

Y128822
[Y128822]

Y128822
hg38 Position: ChrY:21146948..21146948
Ancestral: A
Derived: G
Reference: YFull (2018)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: Y128822_F TTGTGATAAGCCCCCTCAAC
Reverse Primer: Y128822_R GCCAAAAACCATTCATCAGTC
Reviews

Customers who bought this product also purchased
Y128405
Y128405
Y128522
Y128522
Y128413
Y128413
Y128324
Y128324
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies