Top » Catalog » SNPs » ZS11844

$15.00

ZS11844
[ZS11844]

ZS11844
hg38 Position: ChrY:15300427..15300427
Ancestral: G
Derived: A
Reference: Victar Mas (2016)
ISOGG Haplogroup: J1
Comments: downstream ZS10814
Forward Primer: ZS11844_F GTTCTTGCTATGTTGTCCAGGG
Reverse Primer: ZS11844_R CCAGGAGTGAATTTAGAGCTTTAGTG
Reviews

Customers who bought this product also purchased
BY11342
BY11342
ZS11604
ZS11604
ZS11633
ZS11633
ZS4086
ZS4086
ZS2050
ZS2050
ZS10814
ZS10814
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies