Top » Catalog » SNPs » ZS11844

$18.00

ZS11844
[ZS11844]

ZS11844
hg38 Position: ChrY:15300427..15300427
Ancestral: G
Derived: A
Reference: Victar Mas (2016)
ISOGG Haplogroup: J1
Comments: downstream ZS10814
Forward Primer: ZS11844_F GTTCTTGCTATGTTGTCCAGGG
Reverse Primer: ZS11844_R CCAGGAGTGAATTTAGAGCTTTAGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies