Top » Catalog » SNPs » ZS11634

$18.00

ZS11634
[ZS11634]

ZS11634
hg38 Position: ChrY:20795069..20795069
Ancestral: G
Derived: T
Reference: Victar Mas (2016)
ISOGG Haplogroup: J1
Comments: downstream BY5
Forward Primer: ZS11634_F TTTCAAATGAGAGCCCTTGG
Reverse Primer: ZS11634_R CACCAAGTGGGGAGAAAAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies