Top » Catalog » SNPs » ZS11634

$15.00

ZS11634
[ZS11634]

ZS11634
hg38 Position: ChrY:20795069..20795069
Ancestral: G
Derived: T
Reference: Victar Mas (2016)
ISOGG Haplogroup: J1
Comments: downstream BY5
Forward Primer: ZS11634_F TTTCAAATGAGAGCCCTTGG
Reverse Primer: ZS11634_R CACCAAGTGGGGAGAAAAAG
Reviews

Customers who bought this product also purchased
ZS2069
ZS2069
ZS11025
ZS11025
FGC43091
FGC43091
ZS4086
ZS4086
FGC1695
FGC1695
ZS4087
ZS4087
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies