Top » Catalog » SNPs » BY186214

$15.00

BY186214
[BY186214]

BY186214
hg38 Position: ChrY:3015020..3015020
Ancestral: T
Derived: C
Reference: FTDNA (2018)
ISOGG Haplogroup: I1
Comments: Below Z138 > A6552
Forward Primer: BY186214_F GCCAGGTTGGTCTTGATCTC
Reverse Primer: BY186214_R GCCCTGTCTCAGATATTCAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies