Top » Catalog » SNPs » BY39169

$18.00

BY39169
[BY39169]

BY39169
hg38 Position: ChrY:9270001..9270001
Ancestral: G
Derived: T
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: Below L1335 > S764 > FGC17603
Forward Primer: BY39169_F CTTATGATGTGAAGCAACTGCG
Reverse Primer: BY39169_R ACTTCTTTTTTTTGAGTTTCCCAG
Reviews

Customers who bought this product also purchased
BY39170
BY39170
FGC17603
FGC17603
BY39168
BY39168
A19400
A19400
R1b-FGC17603 MacRae Panel
R1b-FGC17603 MacRae Panel
BY41059
BY41059
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies