Top » Catalog » SNPs » BY39171

$18.00

BY39171
[BY39171]

BY39171
hg38 Position: ChrY:9811401..9811401
Ancestral: A
Derived: G
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: Below L1335 > S764 > FGC17603
Forward Primer: BY39171_F CGTGACAATGAGAATGGACC
Reverse Primer: BY39171_R AACAAACATCCTTTCTGTAAATGATG
Reviews

Customers who bought this product also purchased
BY41059
BY41059
BY39172
BY39172
BY39170
BY39170
BY39169
BY39169
FGC17603
FGC17603
BY39168
BY39168
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies