Top » Catalog » SNPs » BY39171

$18.00

BY39171
[BY39171]

BY39171
hg38 Position: ChrY:9811401..9811401
Ancestral: A
Derived: G
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: Below L1335 > S764 > FGC17603
Forward Primer: BY39171_F CGTGACAATGAGAATGGACC
Reverse Primer: BY39171_R AACAAACATCCTTTCTGTAAATGATG
Reviews

Customers who bought this product also purchased
BY39170
BY39170
BY39169
BY39169
FGC17603
FGC17603
BY39168
BY39168
A19400
A19400
R1b-FGC17603 MacRae Panel
R1b-FGC17603 MacRae Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies