Top » Catalog » SNPs » BY41059

$15.00

BY41059
[BY41059]

BY41059
hg38 Position: ChrY:12310952..12310952
Ancestral: G
Derived: A
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: Below L1335 > S764 > FGC17603
Forward Primer: BY41059_F CCAACATGGTGAACTCCTGC
Reverse Primer: BY41059_R GACTTTTAATTGCGTGTAGATTAATGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies