Top » Catalog » SNPs » BY183038

$18.00

BY183038
[BY183038]

BY183038
hg38 Position: ChrY:12732683..12732683
Ancestral: T
Derived: C
Reference: FTDNA (2018)
ISOGG Haplogroup: J2
Comments: .
Forward Primer: BY183038_F ATGTTGGCCAGCATGGTG
Reverse Primer: BY183038_R AAATAATTTAAGAAAAAGTCAAATACGCC
Reviews

Customers who bought this product also purchased
Mail Tracking
Mail Tracking
DNA Sample Kit
DNA Sample Kit
DYR33
DYR33
BY183679
BY183679
BY183199
BY183199
Prepaid Return Envelope
Prepaid Return Envelope
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies