Top » Catalog » SNPs » FGC53804

$18.00

FGC53804
[FGC53804]

FGC53804
hg38 Position: ChrY:14318188..14318188
Ancestral: T
Derived: C
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: J2
Comments: .
Forward Primer: FGC53804_F GAGTCCCTACTGGGGCG
Reverse Primer: FGC53804_R ACTGGCCATAACAAAGAGGTCAC
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
DYR33
DYR33
BY183679
BY183679
BY183199
BY183199
Prepaid Return Envelope
Prepaid Return Envelope
FGC61398
FGC61398
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies