Top » Catalog » SNPs » FGC53809

$18.00

FGC53809
[FGC53809]

FGC53809
hg38 Position: ChrY:15456357..15456357
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: J2
Comments: .
Forward Primer: FGC53809_F GTGAGGCCGAGAAACAAATG
Reverse Primer: FGC53809_R CTCCTTCACACCCTTGATCC
Reviews

Customers who bought this product also purchased
BY183679
BY183679
BY183199
BY183199
Prepaid Return Envelope
Prepaid Return Envelope
FGC61398
FGC61398
Mail Tracking
Mail Tracking
DNA Sample Kit
DNA Sample Kit
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies