Top » Catalog » SNPs » FGC17460

$18.00

FGC17460
[FGC17460]

FGC17460
hg38 Position: ChrY:2945338..2945338
Ancestral: C
Derived: G
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b1a1a2a1a1a1b
Comments: Below U106 > S1855
Forward Primer: FGC17460v2_F TCAGCCTCCTGAGTTGCC
Reverse Primer: FGC17460v2_R CAGTAAGCCGACATCGTACTACTC
Reviews

Customers who bought this product also purchased
BY11544
BY11544
DNA Sample Kit
DNA Sample Kit
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies