Top » Catalog » SNPs » Y146178

$18.00

Y146178
[Y146178]

Y146178
hg38 Position: ChrY:9226272..9226272
Ancestral: G
Derived: T
Reference: YFull (2014)
ISOGG Haplogroup: J2
Comments: .
Forward Primer: Y146178_F GTTAGCCAGGATGGTGTTGATC
Reverse Primer: Y146178_R CCATCTACAGAGATTTTTCGCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies