Top » Catalog » SNPs » Y146184

$18.00

Y146184
[Y146184]

Y146184
hg38 Position: ChrY:21599442..21599442
Ancestral: G
Derived: A
Reference: YFull (2018)
ISOGG Haplogroup: R1b
Comments: Below DF49 > M222 > DF105 > A225
Forward Primer: Y146184_F TCACCCCTTTCTGAACTTATTGTG
Reverse Primer: Y146184_R ATCTGCAGTGAATTGGGAGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies