Top » Catalog » SNPs » Y146197

$18.00

Y146197
[Y146197]

Y146197
hg38 Position: ChrY:21216517..21216517
Ancestral: A
Derived: G
Reference: YFull (2018)
ISOGG Haplogroup: R1b
Comments: Below DF49 > M222 > DF105 > A225
Forward Primer: Y146197_F CTCCACCCATTTGTTTTTCC
Reverse Primer: Y146197_R TGGTTGAGGTAAGAGCCAAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC50887
1 x FGC29847
1 x FGC23319
1 x FGC12805
1 x A17832
1 x A20820
1 x FGC34184
1 x A17373
1 x ALK456
$162.00
Haplogroup Info
Other products
Currencies