Top » Catalog » SNPs » Y146204

$18.00

Y146204
[Y146204]

Y146204
hg38 Position: ChrY:18936808..18936808
Ancestral: T
Derived: G
Reference: YFull (2018)
ISOGG Haplogroup: R1b
Comments: Below DF49 > M222 > DF105 > A225
Forward Primer: Y146204_F TCATTGTTCGACTCGCAATC
Reverse Primer: Y146204_R TGAATCTTCCCCAGAAGTGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies