Top » Catalog » SNPs » BY57181

$18.00

BY57181
[BY57181]

BY57181
hg38 Position: ChrY:3032908..3032908
Ancestral: A
Derived: G
Reference: FTDNA (2018)
ISOGG Haplogroup: N
Comments: Below BY22113 > BY106434
Forward Primer: BY57181_F CTTGGCAATGGTGGGCC
Reverse Primer: BY57181_R TAGATGAAGTTACAGTGTTGAATTTTTATG
Reviews

Customers who bought this product also purchased
BY106434
BY106434
BY103588
BY103588
Wish a SNP
Wish a SNP
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies