Top » Catalog » SNPs » FGC17464

$18.00

FGC17464
[FGC17464]

FGC17464
hg38 Position: ChrY:11702882..11702882
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b1a1a2a1a1a1b1
Comments: Below U106 > S1855
Forward Primer: FGC17464_F AACGGATTCGAATGTAGTGG
Reverse Primer: FGC17464_R ATTGCACTCCCCTCTCTTCC
Reviews

Customers who bought this product also purchased
FTA27608
FTA27608
FT299920
FT299920
BY189328
BY189328
FGC3862
FGC3862
S12025
S12025
S493
S493
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies