Top » Catalog » SNPs » A23931

$18.00

A23931
[A23931]

A23931
hg38 Position: ChrY:13517951..13517951
Ancestral: G
Derived: T
Reference: YSEQ (2019)
ISOGG Haplogroup: R1b
Comments: Below DF27 > Y134945
Forward Primer: A23931_F TGCTGCTAAGAAGAATGTATGTTCTC
Reverse Primer: A23931_R CACAAAACAACATTAACCTTAAATGG
Reviews

Customers who bought this product also purchased
YSEQ-Alpha
YSEQ-Alpha
Whole Genome Sequence
Whole Genome Sequence
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies