Top » Catalog » SNPs » A23931

$18.00

A23931
[A23931]

A23931
hg38 Position: ChrY:13517951..13517951
Ancestral: G
Derived: T
Reference: YSEQ (2019)
ISOGG Haplogroup: R1b
Comments: Below DF27 > Y134945
Forward Primer: A23931_F TGCTGCTAAGAAGAATGTATGTTCTC
Reverse Primer: A23931_R CACAAAACAACATTAACCTTAAATGG
Reviews

Customers who bought this product also purchased
FGC81946
FGC81946
FGCLR1127
FGCLR1127
FGC81931
FGC81931
FGCLR1126
FGCLR1126
BY41294
BY41294
FGC81960
FGC81960
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies