Top » Catalog » SNPs » Y107244

$18.00

Y107244
[Y107244]

Y107244
hg38 Position: ChrY:19533998..19533998
Ancestral: G
Derived: C
Reference: YFull (2017)
ISOGG Haplogroup: R1a
Comments: Below M458 > L260 > YP1337
Forward Primer: Y107244_F GACACAACATGGAATGGGATC
Reverse Primer: Y107244_R GTCAGTGAGATTGCGGGC
Reviews

Customers who bought this product also purchased
Z4624
Z4624
YP258
YP258
R1a-M458 Panel
R1a-M458 Panel
DYS464
DYS464
BY207879
BY207879
Z282
Z282
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies