Top » Catalog » SNPs » Y107244

$18.00

Y107244
[Y107244]

Y107244
hg38 Position: ChrY:19533998..19533998
Ancestral: G
Derived: C
Reference: YFull (2017)
ISOGG Haplogroup: R1a
Comments: Below M458 > L260 > YP1337
Forward Primer: Y107244_F GACACAACATGGAATGGGATC
Reverse Primer: Y107244_R GTCAGTGAGATTGCGGGC
Reviews

Customers who bought this product also purchased
Y140901
Y140901
Z93
Z93
Y184194
Y184194
Z91
Z91
Y72918
Y72918
L145
L145
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies