Top » Catalog » SNPs » Y107244

$18.00

Y107244
[Y107244]

Y107244
hg38 Position: ChrY:19533998..19533998
Ancestral: G
Derived: C
Reference: YFull (2017)
ISOGG Haplogroup: R1a
Comments: Below M458 > L260 > YP1337
Forward Primer: Y107244_F GACACAACATGGAATGGGATC
Reverse Primer: Y107244_R GTCAGTGAGATTGCGGGC
Reviews

Customers who bought this product also purchased
YP1337
YP1337
DYS464
DYS464
BY207879
BY207879
Z282
Z282
Y37285
Y37285
L260
L260
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies