Top » Catalog » SNPs » Y107244

$18.00

Y107244
[Y107244]

Y107244
hg38 Position: ChrY:19533998..19533998
Ancestral: G
Derived: C
Reference: YFull (2017)
ISOGG Haplogroup: R1a
Comments: Below M458 > L260 > YP1337
Forward Primer: Y107244_F GACACAACATGGAATGGGATC
Reverse Primer: Y107244_R GTCAGTGAGATTGCGGGC
Reviews

Customers who bought this product also purchased
Z4624
Z4624
YP258
YP258
R1a-M458 Panel
R1a-M458 Panel
DYS626
DYS626
BY30698
BY30698
M458
M458
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BZ207
1 x AM00750
1 x BZ105
1 x F1288
1 x BY44956
1 x A19683
1 x BY93962
1 x ACT1549
1 x AM00755
1 x B81
1 x BY49212
1 x F2559
1 x A18948
1 x F2613
1 x ACT5750
1 x A1216
1 x BY63108
1 x A705
1 x A15283
1 x A18975
1 x CTS8520
1 x DXYS156
1 x A18956
1 x BY84734
1 x A15484
1 x AMM035
1 x F741
1 x B33
1 x BY72441
1 x BY13835
1 x BY162241
1 x DYS713
1 x A17888
1 x BY33084
1 x BY15683
1 x A25122
1 x A15449
1 x BY15625
1 x CTS10639
1 x BY22083
1 x BY38326
1 x F725
1 x A16526
1 x DYS445
1 x BY103174
1 x ACT4525
1 x BY161282
1 x A13553
1 x ACT1657
1 x AM00600
1 x BY75937
1 x ACT3796
1 x CTS3910
1 x A14899
$955.00
Haplogroup Info
Other products
Currencies