Top » Catalog » SNPs » Y107244

$18.00

Y107244
[Y107244]

Y107244
hg38 Position: ChrY:19533998..19533998
Ancestral: G
Derived: C
Reference: YFull (2017)
ISOGG Haplogroup: R1a
Comments: Below M458 > L260 > YP1337
Forward Primer: Y107244_F GACACAACATGGAATGGGATC
Reverse Primer: Y107244_R GTCAGTGAGATTGCGGGC
Reviews

Customers who bought this product also purchased
Y72918
Y72918
L145
L145
PF6155
PF6155
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
Y17491
Y17491
L62
L62
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies