Top » Catalog » SNPs » BY39360

$18.00

BY39360
[BY39360]

BY39360
hg38 Position: ChrY:21431524..21431524
Ancestral: T
Derived: G
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: BY39360_F TATATTTTATACTGTTAAGAATACTCATTATTGAAG
Reverse Primer: BY39360_R GTGTGTGTGAAGTATGGTATCTCATTG
Reviews

Customers who bought this product also purchased
FGCLR1127
FGCLR1127
BY41294
BY41294
FGCLR1126
FGCLR1126
A23931
A23931
FGC81960
FGC81960
YSEQ-Alpha
YSEQ-Alpha
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies