Top » Catalog » SNPs » BY39360

$18.00

BY39360
[BY39360]

BY39360
hg38 Position: ChrY:21431524..21431524
Ancestral: T
Derived: G
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: BY39360_F TATATTTTATACTGTTAAGAATACTCATTATTGAAG
Reverse Primer: BY39360_R GTGTGTGTGAAGTATGGTATCTCATTG
Reviews

Customers who bought this product also purchased
Whole Genome Sequence
Whole Genome Sequence
FGC81946
FGC81946
BY41295
BY41295
FGC81931
FGC81931
FGCLR1127
FGCLR1127
BY41294
BY41294
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies