Top » Catalog » SNPs » FGC81946

$18.00

FGC81946
[FGC81946]

FGC81946
hg38 Position: ChrY:6789349..6789349
Ancestral: A
Derived: G
Reference: Full Genomes Corp. (2018)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FGC81946_F TTTTATATGATCTTCCTCTTTACAATGC
Reverse Primer: FGC81946_R AATCTTTGCCACAGGAGGG
Reviews

Customers who bought this product also purchased
Whole Genome Sequence
Whole Genome Sequence
BY39360
BY39360
BY41295
BY41295
FGC81931
FGC81931
FGCLR1127
FGCLR1127
BY41294
BY41294
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies