Top » Catalog » SNPs » FGC81946

$18.00

FGC81946
[FGC81946]

FGC81946
hg38 Position: ChrY:6789349..6789349
Ancestral: A
Derived: G
Reference: Full Genomes Corp. (2018)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FGC81946_F TTTTATATGATCTTCCTCTTTACAATGC
Reverse Primer: FGC81946_R AATCTTTGCCACAGGAGGG
Reviews

Customers who bought this product also purchased
BY41294
BY41294
FGCLR1126
FGCLR1126
A23931
A23931
FGC81960
FGC81960
YSEQ-Alpha
YSEQ-Alpha
FGC81969
FGC81969
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies