Top » Catalog » SNPs » FGC81960

$18.00

FGC81960
[FGC81960]

FGC81960
hg38 Position: ChrY:16044504..16044504
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2018)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FGC81960_F GTTCATTGATTTTTGAAGAGATTTTATC
Reverse Primer: FGC81960_R ACACCAATAATAGTGGGAGACTCAAC
Reviews

Customers who bought this product also purchased
YSEQ-Alpha
YSEQ-Alpha
BY39360
BY39360
Whole Genome Sequence
Whole Genome Sequence
FGC81946
FGC81946
BY41295
BY41295
FGC81931
FGC81931
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies