Top » Catalog » SNPs » FGCLR1126

$18.00

FGCLR1126
[FGCLR1126]

FGCLR1126
hg38 Position: ChrY:14971640..14971640
Ancestral: A
Derived: G
Reference: Full Genomes Corp. (2018)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FGCLR1126_F TAACATTAGGTATATCTCCGAATGCTC
Reverse Primer: FGCLR1126_R GCAAAGGATATGAACAGACACCTG
Reviews

Customers who bought this product also purchased
FGC81969
FGC81969
YSEQ-Alpha
YSEQ-Alpha
BY39360
BY39360
Whole Genome Sequence
Whole Genome Sequence
FGC81946
FGC81946
BY41295
BY41295
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies