Top » Catalog » SNPs » FGCLR1126

$18.00

FGCLR1126
[FGCLR1126]

FGCLR1126
hg38 Position: ChrY:14971640..14971640
Ancestral: A
Derived: G
Reference: Full Genomes Corp. (2018)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FGCLR1126_F TAACATTAGGTATATCTCCGAATGCTC
Reverse Primer: FGCLR1126_R GCAAAGGATATGAACAGACACCTG
Reviews

Customers who bought this product also purchased
FGC81931
FGC81931
FGCLR1127
FGCLR1127
BY41294
BY41294
FGC81960
FGC81960
A23931
A23931
FGC81969
FGC81969
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies