Top » Catalog » SNPs » FGCLR1127

$18.00

FGCLR1127
[FGCLR1127]

FGCLR1127
hg38 Position: ChrY:15663195..15663195
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2018)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FGCLR1127_F TATTTATTTATTATACTTTAAGTTGTGGGATATAAG
Reverse Primer: FGCLR1127_R CATTGAAGAAATGCAGATCAAAAG
Reviews

Customers who bought this product also purchased
BY41294
BY41294
FGC81960
FGC81960
A23931
A23931
FGC81969
FGC81969
YSEQ-Alpha
YSEQ-Alpha
BY39360
BY39360
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies