Top » Catalog » SNPs » A24016

$18.00

A24016
[A24016]

A24016
hg38 Position: ChrY:7844516..7844516
Ancestral: C
Derived: G
Reference: YSEQ (2019)
ISOGG Haplogroup: J2
Comments: .
Forward Primer: A24016_F CCCTTCCTTACATCTTGTAAAAAACTAG
Reverse Primer: A24016_R GGCTGGGTCAAATGGTATTC
Reviews

Customers who bought this product also purchased
A24024
A24024
A24018
A24018
A24023
A24023
A24017
A24017
A24022
A24022
A24015
A24015
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies