Top » Catalog » SNPs » A24017

$18.00

A24017
[A24017]

A24017
hg38 Position: ChrY:8634012..8634012
Ancestral: A
Derived: T
Reference: YSEQ (2019)
ISOGG Haplogroup: J2
Comments: .
Forward Primer: A24017_F AGCTGAGGCCTGTCAGTGTC
Reverse Primer: A24017_R ATCGGGAGTTTGATAGGATGC
Reviews

Customers who bought this product also purchased
YSEQ-XTD
YSEQ-XTD
Y166607
Y166607
DYF399X
DYF399X
DYS464X
DYS464X
A24015
A24015
A24021
A24021
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies