Top » Catalog » SNPs » A24023

$18.00

A24023
[A24023]

A24023
hg38 Position: ChrY:14335931..14335931
Ancestral: G
Derived: C
Reference: YSEQ (2019)
ISOGG Haplogroup: J2
Comments: .
Forward Primer: A24023_F CATGGTTGGAGGGTGGTG
Reverse Primer: A24023_R CACAATTATGGCAGAGGACAAAG
Reviews

Customers who bought this product also purchased
Y166607
Y166607
DYF399X
DYF399X
DYS464X
DYS464X
YSEQ-XTD
YSEQ-XTD
A24018
A24018
A24024
A24024
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies