Top » Catalog » SNPs » A24024

$18.00

A24024
[A24024]

A24024
hg38 Position: ChrY:18894387..18894387
Ancestral: G
Derived: T
Reference: YSEQ (2019)
ISOGG Haplogroup: J2
Comments: .
Forward Primer: A24024_F AGGGCGAGGCATTGCG
Reverse Primer: A24024_R ACCCACTTGAGGAGGCAGTG
Reviews

Customers who bought this product also purchased
A24017
A24017
A24022
A24022
A24016
A24016
A24021
A24021
A24015
A24015
A24020
A24020
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies