Top » Catalog » SNPs » A24025

$18.00

A24025
[A24025]

A24025
hg38 Position: ChrY:19116913..19116913
Ancestral: G
Derived: T
Reference: YSEQ (2019)
ISOGG Haplogroup: J2
Comments: .
Forward Primer: A24025_F CCTGCCTGATTGCCTTGC
Reverse Primer: A24025_R GATCCATGATGAACATCAATGTAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies