Top » Catalog » SNPs » A24026

$18.00

A24026
[A24026]

A24026
hg38 Position: ChrY:20939582..20939582
Ancestral: T
Derived: C
Reference: YSEQ (2019)
ISOGG Haplogroup: J2
Comments: .
Forward Primer: A24026_F GTATGGCCATTTTCATGATATTGC
Reverse Primer: A24026_R AACCATATGATTATTTCAATATATGAAGAAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies