Top » Catalog » SNPs » FGC64334

$18.00

FGC64334
[FGC64334]

FGC64334
hg38 Position: ChrY:19542252..19542252
Ancestral: G
Derived: T
Reference: Full Genomes Corp. (2017)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC64334_F TTGCAACAGCATAAAGGGAAC
Reverse Primer: FGC64334_R GGCAGGGCTTAAACAGACAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies